Recent Updates
Recently added Catalysts
PRME Positive Sentiment Score: 75/100

Prime Medicine st 41 Annual J.P. Morgan Healthcare Conference January 2023 1 Forward-Looking Statements This presentation contains forward-looking statements of Prime Medicine, Inc. ("Prime", "we" or "our") within the me

Key Takeaway: Prime Medicine presented at the 41st Annual J.P. Morgan Healthcare Conference in January 2023, sharing insights on its forward-looking strategies and the potential of its Prime Editing technology. The company aims to advance genetic therapies targeting various diseases, emphasizing the versatility and precision of its platform. With ongoing studies and multiple programs advancing toward development candidates, Prime Medicine anticipates its first investigational new drug filing as early as 2024. The presentation highlights the company's commitment to innovative therapeutic solutions in gene editing.

Market Sentiment Analysis

POSITIVE FACTORS

  • Prime Medicine is positioned to deliver one-time, curative genetic therapies.
  • The Prime Editing technology shows minimal off-target effects and high precision.
  • The company has progressed a pipeline of 18 programs focused on promising indications.

Full Press Release Details

Conference January 2023 1
Forward-Looking Statements This presentation contains forward-looking
statements of Prime Medicine, Inc. ("Prime", "we" or "our") within the meaning of the Private Securities Litigation Reform Act of 1995. These forward-looking statements contain information about our current and
future prospects and our operations and financial results, which are based on currently available information. All statements other than statements of historical facts contained in this presentation, including statements regarding our strategy,
future financial condition, future operations, projected costs, prospects, plans, objectives of management and expected market growth, are forward-looking statements. In some cases, you can identify forward-looking statements by terminology such as
aim,'' anticipate,'' assume,'' believe,'' contemplate,'' continue,''
could,'' design,'' due,'' estimate,'' expect,'' goal,'' intend,''
may,'' objective,'' "opportunity," plan,'' predict,'' positioned,'' potential,''
seek,'' should,'' target,'' will,'' would'' and other similar expressions that are predictions of or indicate future
events and future trends, or the negative of these terms or other comparable terminology. These forward-looking statements include, but are not limited to, express or implied statements about Prime's beliefs and expectations regarding: the
initiation, timing, progress and results of our research and development programs, preclinical studies and future clinical trials; our ability to demonstrate, and the timing of, preclinical proof-of-concept in vivo for multiple programs; our ability
to advance any product candidates that we may identify and successfully complete any clinical studies, including the manufacture of any such product candidates; our ability to pursue our four strategic indication categories: immediate target
indications, differentiation target indications, "blue sky" indications and "march up the chromosome" approaches; our ability to quickly leverage programs within our initial target indications and to progress additional
programs to further develop our pipeline; the timing of our regulatory filings, including our investigational new drug applications submissions; the implementation of our strategic plans for our business, programs and technology; the scope of
protection we are able to establish and maintain for intellectual property rights covering our Prime Editing technology; developments related to our competitors and our industry; our ability to leverage the clinical, regulatory, and manufacturing
advancements made by gene therapy and gene editing programs to accelerate our clinical trials and approval of product candidates; our ability to identify and enter into future license agreements and collaborations; developments related to our Prime
Editing technology; regulatory developments in the United States and foreign countries; our ability to attract and retain key scientific and management personnel; our estimates of our expenses, capital requirements, and needs for additional
financing as well as our cash runway into 2025; and general economic, industry and market conditions, including rising interest rates and inflation. Actual results or events could differ materially from the plans, intentions and expectations
disclosed in the forward-looking statements we make due to a number of risks and uncertainties. These and other risks, uncertainties and important factors are described in the section entitled Risk Factors in our most recent Quarterly Report on Form
10-Q, as well as any subsequent filings with the Securities and Exchange Commission. Any forward-looking statements represent our views only as of the date of this presentation and we undertake no obligation to update or revise any forward-looking
statements, whether as a result of new information, the occurrence of certain events or otherwise. We may not actually achieve the plans, intentions or expectations disclosed in our forward-looking statements, and you should not place undue reliance
on our forward-looking statements. No representations or warranties (expressed or implied) are made about the accuracy of any such forward-looking statements. Certain information contained in this presentation relates to or is based on studies,
publications, surveys and other data obtained from third-party sources and our own internal estimates and research. While we believe these third-party studies, publications, surveys and other data to be reliable as of the date of this presentation,
we have not independently verified, and make no representation as to the adequacy, fairness, accuracy or completeness of, any information obtained from third-party sources. In addition, no independent source has evaluated the reasonableness or
accuracy of our internal estimates or research and no reliance should be made on any information or statements made in this presentation relating to or based on such internal estimates and research. 2
30 years after the first patient was treated with gene therapy, gene
editing is only just beginning to demonstrate clinical benefit. Now is the moment for a revolution. Prime Medicine brings together the right people and the right technology at the right time with the aim to deliver the promise of one-time, curative
genetic therapies to address the widest spectrum of diseases. 3
Delivering the full promise of gene editing requires an extremely
powerful technology Prime Editing (PE) stands out as a best-in-class genetic medicine approach Versatility: only gene editing technology with the capability to edit, correct, insert, and delete Performs and corrects insertions, deletions,
and all twelve types of single base pair corrections Precisely targets to insert or delete kilobase-sized DNA Easily programmable to a unique target location and for a broad set of edits Restores gene function for multiple
mutations with a single product (i.e., "hotspots") Precision: May be much safer with minimal, or no, off-target editing Does not create double stranded breaks: high specificity with low indels rate at targeted editing site
Does not create double stranded breaks: minimal or no off-target activity Limited potential for "bystander editing" at target site Efficiency: Durable and high-efficiency editing demonstrated across Prime Medicine
portfolio Permanent edits that are passed along to daughter cells Corrects genes in situ, maintaining native gene control Single-dose, potentially curative correction to wild-type sequence Breadth: Able to address ~90% of
disease-causing mutations in multiple tissue types and cells Corrects mutations in dividing and non-dividing human cells 100's of potential indications already available in Prime Editing's toolbox 4
Delivering the full promise of gene editing requires an extremely
powerful technology Prime Editing (PE) stands out as a best-in-class genetic medicine approach Versatility: only gene editing technology with the capability to edit, correct, insert, and delete Performs and corrects insertions, deletions,
and all twelve types of single base pair corrections Precisely targets to insert or delete kilobase-sized DNA Easily programmable to a unique target location and for a broad set of edits Restores gene function for multiple
mutations with a single product (i.e., "hotspots") Precision: May be much safer with minimal, or no, off-target editing Does not create double stranded breaks: high specificity with low indels rate at targeted editing site
Does not create double stranded breaks: minimal or no off-target activity Limited potential for "bystander editing" at target site Efficiency: Durable and high-efficiency editing demonstrated across Prime Medicine
portfolio Permanent edits that are passed along to daughter cells Corrects genes in situ, maintaining native gene control Single-dose, potentially curative correction to wild-type sequence Breadth: Able to address ~90% of
disease-causing mutations in multiple tissue types and cells Corrects mutations in dividing and non-dividing human cells 100's of potential indications already available in Prime Editing's toolbox 5
Prime Medicine is well-positioned to maximize Prime Editing's
broad therapeutic potential In ~2.5 years since company inception: Identified and progressed initial pipeline of 18 programs Focusing on indications with the fastest, most direct path to demonstrating technological success, as well as
diseases that cannot be treated using other gene-editing approaches In vivo studies in progress across portfolio; multiple programs advancing toward development candidates, with first IND filing potentially as early as 2024 Demonstrated
Prime Editing capabilities: established preclinical proof-of-concept and safety In vivo long-term engraftment of Prime Edited hematopoietic stem cell therapy for Chronic Granulomatous Disease Built and Efficient removal of
pathological repeats in Friedrich's Ataxia, a Repeat Expansion Disease, with phenotypic correction in patient organoids advanced a Efficient editing with phenotypic correction of cystic fibrosis patient organoids strategic portfolio
Advanced CMC and delivery capabilities Efficient in vivo Prime Editing in rodent liver and central nervous system Optimized and expanded Prime Editing platform, capabilities and IP One-step non-viral precise insertion of whole genes
into the genome in primary human cells using PASSIGE technology Industrialized and automated Prime Editor screening capabilities Advanced and substantially improved Prime Editing Developed strong Intellectual Property
position Led by world-class, diverse team of researchers and drug developers; grew company to ~200 employees Established Raised ~$315M in Series A/B, and ~$200M in IPO (Oct 22), from a blue-chip group of investors strong corporate Leveraging
close relationship with founders David Liu and Andrew Anzalone to bring new innovation rapidly into Prime Medicine position Aim to create additional value and extend reach through BD and partnering in 2023 6
Our current portfolio of 18 programs leverages the versatility and
breadth of Prime Editing To be discussed in detail today STRATEGIC TARGET INDICATION DELIVERY DISCOVERY* IND-ENABLING CLINICAL TRIALS CATEGORY TISSUE Sickle Cell Disease ex vivo BLOOD Chronic Granulomatous Disease ex vivo Fanconi Anemia ex vivo
Wilson's Disease LNP LIVER Glycogen Storage Disease 1b LNP IMMEDIATE Retinitis Pigmentosa/Rhodopsin AAV EYE Retinitis Pigmentosa/Usher Syndrome AAV Usher Syndrome Type 3 AAV EAR Non-Syndromic Hearing Loss - GJB2 AAV Friedreich's
Ataxia viral/non-viral Myotonic Dystrophy Type 1 viral/non-viral Amyotrophic Lateral Sclerosis viral/non-viral NEURO- DIFFERENTIATION: MUSCULAR Oculopharyngeal Muscular Dystrophy LNP REPEAT EXPANSION DISEASES Fragile X Syndrome viral/non-viral
Huntington's Disease TBD EYE Fuchs' Endothelial Corneal Dystrophy viral/non-viral MUSCLE Duchenne Muscular Dystrophy AAV DIFFERENTIATION: OTHER LUNG Cystic Fibrosis LNP Initially focused on our first two strategic indication categories
in diseases where Prime Editing could offer compelling advantages over current standard-of-care and novel therapeutic modalities in development AAV = adeno-associated viral vectors; LNP = lipid nanoparticles; TBD = to be determined 7 *As of IPO
Ex-Vivo HSC Successful Prime Editing in long-term HSC population: in
vivo engraftment in Chronic Granulomatous Disease mouse model Maintenance of >92% corrected long-term HSCs following 16-week engraftment + + Prime Editor Naive CD34 Edited CD34 NBSGW mice Cryopreserve/Thaw 0hr 24hr 0 weeks 16 weeks Editing
performed by electroporation + No difference in engraftment for PE Long-term engrafted CD34 HSCs Edited HSCs vs controls carry precise correction of NCF1 Conclusions 100 100 High efficiency, very precise editing of HSCs 80 80
High-level, long-term engraftment resulting in 60 60 healthy Prime Edited long-term HSCs Restores key myeloid function to fight infection 40 40 Generate all lineages without skewing Minimum 20 20 Mice are healthy at 16
weeks, no toxicity threshold for patient benefit Recapitulates the expected clinical study design 0 0 Mock Prime Unedited Prime Edited Edited W41J + scid tm1Wjl + NBSGW: NOD.Cg-Kit Tyr Prkdc Il2rg /ThomJ highly immunodeficient mice that
support human CD34 cell engraftment without irradiation. HSC: hematopoietic stem cell. PE: Prime Edited. 8 Bone Marrow Chimerism (% human CD45+) Cells corrected (%)
Methylation (%) Repeat Expansion Diseases Successful Prime Editing
removal of pathogenic repeats: Friedreich's ataxia High efficiency Prime Editing removes the GAA pathological repeats and hyper-methylation at the Frataxin Dual-flap correction of FXN in FRDA iPSCs (FXN) gene in Friedreich's Ataxia
patients Hyper-methylation prevents Demethylation by Prime Editing restores 100 Expanded Repeat mRNA transcription of FXN mRNA transcription of FXN 5 active prime editors negative controls Dual-flap Prime Editing Prime loops out expanded repeat
Editing X 80 Promoter Exon 1 Intron 1 Promoter Exon 1 Intron 1 Repeats Prime Edited 60 1 Removal of Hyper-Methylation 40 80 Healthy 20 60 Patient 0 40 FRDA iPSCs* 20 Patient High efficiency, very precise editing of patient cells Prime
Edited without double strand breaks 0 -327 -239 -236 427 431 460 466 477 506 Restores normal methylation of FXN gene Promoter Intron 1 Many repeat expansion diseases exhibit hyper-methylation as a key feature of the underlying pathogenesis
9 FXN: frataxin gene: FRDA: Friedreich's ataxia; iPSCs: induced pluripotent stem cells. 1 Methylation quantified by bisulfite sequencing % precise correction % precise correction
Repeat Expansion Diseases Successful Prime Editing removal of
pathogenic repeats High efficiency Prime Editing restores FXN protein expression and sensory neuron function in Friedreich's Ataxia patients' dorsal root ganglia Restoration of axonal III-TUB projections after prime editing
Restoration of Frataxin protein DAPI expression after Prime Editing Frataxin (mature) 12 kDa 40 kDa GAPDH Control FRDA patient iPSCs Healthy Donor FRDA Patient FRDA Patient Prime-Edited 10 FXN: Frataxin; FRDA: Friedreich's Ataxia; iDRG: iPSC-derived
dorsal root ganglia. DAPI: nuclear staining; III-TUB: axonal projection staining
Unmet need in CF Unmet needs in Cystic Fibrosis: Restoring CFTR
function in patients with G542X mutation One-time, non-viral delivery to patient intestinal organoids restores CFTR function Optimization results in high efficiency Prime Prime Editing of patient intestinal organoids Editors that precisely correct
G542X restores swelling and CFTR function mutation Intestinal organoids swelling assay for CFTR function Healthy control G542X with mock treatment 1 2 3 4 5 Prime Editing G542X with G542X with Prime Optimizations TRIKAFTA treatment Editing
correction 11 Van Mourik et al., 2019. Actual time course: 24 hours. TRIKAFTA is a registered trademark of Vertex Pharmaceuticals, Incorporated. % precise correction
Off-Target Safety: Prime's comprehensive suite of assays for off-
target discovery* GGCCCAG-CTGAGCTCGTGA Local off-targets Chromosome scale or structural off-targets Off-target PE2 GGCCCAGACTGAGCACGTGA Translocations PE2 cDNA synthesis genome On-target Large Deletions Reverse Trans. Assay Chromosomal Integrity
Assays Targeted Nick Genome wide Genome wide Nick ** ** Detection Assay DSB detection Detection Assay mRNAseq Imaging Sequencing based PEG integration potential off-target editing sites Whole Genome Vector Integration Sequencing Analysis Targeted
Sequencing (>1000x) Identified Identified Off-targets Off-targets * ** 12 Preliminary plans pending discussions with regulatory agencies; Proprietary assay developed by Prime
Off-Target Safety: Preliminary off-target analyses demonstrate minimal
or no off-target editing Data expands the demonstration of no off-target editing detected across multiple prime edited cell types Wilsons Disease 1 CGD Program: CD34+ Cells Genome wide and 2 Program: Hepatocytes targeted detection of potential off-
targets On-target (ATP7B) On-target (NCF1) potential off- target editing sites Targeted Sequencing 0.5% threshold Identified off-targets 1 2 13 Analysis of edited CD34+ cells from CGD program: Targeted Analysis of 550 potential off-target sites of
off-target editing. Analysis of edited iHEP (iPSG hepatocyte) cells from the Wilsons Disease program: Targeted Analysis of 170 potential off-target sites. SNP: Single nucleotide polymorphisms
LNP Delivery LNP Delivery: Optimization of mRNA increases Prime Editing
efficiency and leads to reduction of PCSK9 protein in serum Prime Editor LNP delivered to the liver a precisely introduced stop codon in PCSK9 gene in mice Prime Editor LNP delivered systemically Prime Editor mRNA Prime editor guide
RNA Day 0 Day 7 Optimized mRNA Optimized mRNA decreases PCSK9 protein increases Prime Editing 0 50 -20 40 -40 30 -60 20 -80 10 -100 0 mRNA lot # mRNA lot # Saline 1 2 3 Saline 1 2 3 14 LNP delivery to mice results in 42% PCSK9 Prime Editing and 92%
serum protein reduction Precise Editing (%) Protein Reduction (%)
Dual AAV Delivery Prime Editing Delivery: CSF and Local Administration
to CNS via dual AAV achieves high efficiency in mouse brain 2 Dual AAV effectively delivers to ~ 95%, and precisely edits ~80%, of neurons in adult mice Prime Editor dual AAV Prime Editor Prime editor dual guide RNA 1 0 weeks 3-5
weeks 1 1 Neonatal mice - ICV infusion Adult mice - local administration transduced cortex (left) and precisely transduced neurons (left) and precisely edited cortical cells (right) 2 edited neurons (right) Isolate Isolate transduced
transduced cells neurons Measure editing Measure editing Transduced Prime Edited Transduced Prime Edited 1 2 15 Three weeks in neonatal mice via intra-cerebral infusion (ICV); 5 weeks in adult mice via local administration into cerebellum or cortex.
Prime Editor cassette with neuron-specific promoter. All experiments shown are Proof of Concept delivery experiments using a control Prime Editor site. % of cells transduced % precise correction % of neurons transduced % precise correction in
Prime Medicine has rapidly advanced and substantially improved Prime
Editing Prime Medicine holds foundational IP and has filed for IP protection for technological advancements Patent portfolio includes U.S. Patent 11,447,770 covering methods of using Prime Editors, and US allowed application
17/219,635 covering pegRNAs (expected to issue Q1 2023) 1 3 Seminal Prime Editing Publication PASSIGE System PE4, PE5, and PEmax Novel PE Proteins All base pair edits, insertions of 40+ bp, Advanced PE+ recombinase approach Up
to 7-fold increase in editing 80+ active RT domains deletions of 80+ bp Targeted whole gene insertions with up to Up to 2-fold decrease in byproducts RT domains up to 60% smaller Efficiencies ranging from
~10%-60% 60% efficiency Up to 2-fold increase in editing Targeted introduction of recombinase site 2 4 pegRNA Enhancements Dual Flap Prime Editing Engineered pegRNAs New classes of efficiency-increasing Efficiencies
80% Improved pegRNA stability pegRNAs enhancements Hotspot editing and larger insertions Up to 4-fold increase in editing Synergies with recombinase enzymes (>5-kb targeted DNA integration) 16 : 1 2 3 4 Peer

Frequently Asked Questions

What are forward-looking statements?

Forward-looking statements are predictions about future events and trends, based on current information.

What makes Prime Editing technology unique?

Prime Editing can edit, correct, insert, and delete genetic sequences with high precision and safety.

How does Prime Medicine ensure safety in editing?

Prime Editing minimizes off-target effects, avoiding double-stranded breaks and reducing risks.

What is the current focus of Prime Medicine's pipeline?

Prime Medicine targets diseases with a direct path to success and those untreatable by other methods.

What progress has Prime Medicine made recently?

In 2.5 years, Prime Medicine has advanced 18 programs, with potential IND filing as soon as 2024.

Last updated: Jan 9, 2023